View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9470_low_25 (Length: 219)
Name: NF9470_low_25
Description: NF9470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9470_low_25 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 26592354 - 26592584
Alignment:
| Q |
1 |
ctaggttttttgtagataaccgttgctattgctatgagtttctcttaaggatcttgtgatgttgtaattgtgcttaatgctct--atcaatgaaattaat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
26592354 |
ctaggttttttgtagataaccgttgctatttctatgaatttctcttaaggatcttgtgatgttgtaattctgcttaatactctctatcaatgaaattaat |
26592453 |
T |
|
| Q |
99 |
cgttttttggtcaattatttctttttgttagctgttctaagccctaattttccttca----------atttgttcaattatttctctttgtgatctgttc |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
26592454 |
cgttttttggtcaattatttctttttgttagctgttctaagccctaattttccttcaatttgtttcgatttgttcaattatttctttttgtgatctgttc |
26592553 |
T |
|
| Q |
189 |
ctaaacctaattcataaaagtatatcgtatc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26592554 |
ctaaacctaattcataaaagtatatcgtatc |
26592584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University