View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9471_high_2 (Length: 369)
Name: NF9471_high_2
Description: NF9471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9471_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 18 - 337
Target Start/End: Original strand, 2268474 - 2268793
Alignment:
| Q |
18 |
acttagtctgttgccactttcgttattagttgatttatcagttaatttatgtctaccacttgattttttcagacatgaaaaaactttgtatattagttaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2268474 |
acttagtctgttgccactttcgttattagttgatttatcagttaatttatgtctatcacttgattttttcagacatgaaaaaactttgtatattagttaa |
2268573 |
T |
 |
| Q |
118 |
tcggtatgtagttgttttgttaggtggctacctatttctctcacatgtatataattaattggtttttgttgttgcccatatcagctcttatagattcttt |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2268574 |
tcggtatgtagttattttgttaggtggctacctatttctctcacatgtatataattaattggtttttgttgttgcccatatcagctcttatagattcttt |
2268673 |
T |
 |
| Q |
218 |
tctaaaatgagacaagattattacttgtctttgatacataagttgttatgtggttttattagggcctatagtgtgctgggtattatggtctaaataggta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2268674 |
tctaaaatgagacaagattattacttgtctttgatacataagttgttatgtggttttattagggcctatagtgtgctgggtattatggtctaaataggta |
2268773 |
T |
 |
| Q |
318 |
atatgagaaaaattctttgt |
337 |
Q |
| |
|
|| |||||| |||||||||| |
|
|
| T |
2268774 |
atctgagaagaattctttgt |
2268793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 322
Target Start/End: Original strand, 2268809 - 2268851
Alignment:
| Q |
280 |
ggcctatagtgtgctgggtattatggtctaaataggtaatatg |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
2268809 |
ggcctatagtgtgctgggtattatggtctaaatgggtattatg |
2268851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 302
Target Start/End: Original strand, 2268865 - 2268899
Alignment:
| Q |
268 |
tggttttattagggcctatagtgtgctgggtatta |
302 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2268865 |
tggttttatcagggcctatagtgtgctgggtatta |
2268899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University