View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9471_high_7 (Length: 244)
Name: NF9471_high_7
Description: NF9471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9471_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 30403570 - 30403813
Alignment:
| Q |
1 |
cctccaactcggaaatttagtggttagtttgttgatcagcatctagtttgaaacacttgatcttttatgtgggggaatatcagaagttcaatcattttct |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30403570 |
cctccaactcggaactttagtggttagtttgttgatccgcatctattttgaaacacttgatcttttatgtgggggaatatcagaagttcaatcattttct |
30403669 |
T |
 |
| Q |
101 |
attggtattttcattattgtaaatggttatttactccgattgcagaataaatatgaaaaatatagttggagaaagaaaagaatgttaaggaggaggttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30403670 |
attggtattttcattattgtaaatggttatttactccgattgcagaataaatatgaaaaatatagttggagaaagaaaagaatgttaaggaggaggttag |
30403769 |
T |
 |
| Q |
201 |
-gagggttatcttttggttactttctttgatgtccatctcattg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
30403770 |
tgagggttatcttttggttactttctttgaaggccatcacattg |
30403813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University