View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9471_low_18 (Length: 218)
Name: NF9471_low_18
Description: NF9471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9471_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 12 - 204
Target Start/End: Original strand, 31186584 - 31186778
Alignment:
| Q |
12 |
ggaggagcagagtgaatatgtattggtttttgctagtggaaaccattttct--tgttatcaaagaaagcttcgttgaggcnnnnnnnnnnnnnnnnnnnn |
109 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31186584 |
ggaggaacagagccaatatgtattggtttttgctagtggaaaccattttctattgttatcaaagaaagcttcgttgaggcgtgtgtgtgtgtaatgtgtg |
31186683 |
T |
|
| Q |
110 |
nnnttgagggagaaatgtaaattggtatgaattgaaggcaatagcattgatagtttatatagagatcatatagaatttaaattaatctgaatctg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31186684 |
tgtttgagggagaaatgtaaattggtatgaattgaaggcaatagcattgatagtttatatagagatcatatagaatttagattaatctgaatctg |
31186778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 26 - 88
Target Start/End: Original strand, 31195245 - 31195307
Alignment:
| Q |
26 |
aatatgtattggtttttgctagtggaaaccattttcttgttatcaaagaaagcttcgttgagg |
88 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31195245 |
aatatgtgttgtttttggctagtggaaaccattttcttgttatcaaagaaagctttgttgagg |
31195307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 113 - 203
Target Start/End: Original strand, 31195321 - 31195409
Alignment:
| Q |
113 |
ttgagggagaaatgtaaattggtatgaattgaaggcaatagcattgatagtttatatagagatcatatagaatttaaattaatctgaatct |
203 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||| | |||| | |||||||||||||| || ||| | ||||||||||||||||| |
|
|
| T |
31195321 |
ttgagggagaaaagtaaattggtatgaatcgaaggcaatggtattggtggtttatatagagat--tacagactctaaattaatctgaatct |
31195409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University