View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9471_low_19 (Length: 211)
Name: NF9471_low_19
Description: NF9471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9471_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 33791382 - 33791562
Alignment:
| Q |
13 |
tggtgttgaaggtaaggatccattggtgtttttggatcaaaacacttcttttgtgtttgatcatcaattttataatcagattttgttggggagaggtgtg |
112 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791382 |
tggtgttgaaggtaaggatccattagtgtttttggatcaaaacacttcttttgtttttgatcatcaattttataatcagattttgttggggagaggtgtg |
33791481 |
T |
 |
| Q |
113 |
ttaacaattgaccagaatttggctctagattccatttccaaaggggttgtcacaggttttgcaagaaatggtgagaatttt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791482 |
ttaacaattgaccagaatttggctctagattccatttccaaaggggttgtcacaggttttgcaagaaatggtgagaatttt |
33791562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University