View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9472_high_9 (Length: 203)
Name: NF9472_high_9
Description: NF9472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9472_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 31 - 188
Target Start/End: Original strand, 51111329 - 51111486
Alignment:
| Q |
31 |
acacacaagaaagatcttctcttctatagaagatgtcatcatgaaaagcttaaagctcaggatctcggcgttgtccacccaatttttgctttgcagcttc |
130 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51111329 |
acacataagaaaggtcttctcttctatagaagatgtcatcatgagaagcttaaagctcaggatctcggcgttgtccacccaatttttgctttgcagcttc |
51111428 |
T |
 |
| Q |
131 |
atagtttgaggctatggtttccttggctgcatttgctatgttacttgctttctctgct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51111429 |
atagtttgaggctatggtttccttggctgcatttgctatgttacttgctttctctgct |
51111486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University