View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9472_low_24 (Length: 202)
Name: NF9472_low_24
Description: NF9472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9472_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 17 - 183
Target Start/End: Complemental strand, 13204173 - 13204013
Alignment:
| Q |
17 |
attctatacataacttgcatgcaatagtatatgcttctatgttgtttgaagcatggacactacttaacttgaattaagtatgtcccgtccgacaggacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
13204173 |
attctatacataacttgcatgcaatagtatatgcttctatgttgtttgaaccatggacact-----acttgaattaagtatgtcctgtccgacacgacac |
13204079 |
T |
 |
| Q |
117 |
tcacacatataatttatattaaattaagtaattttctcaaattatcggtgtcagtgtgttagcgtgt |
183 |
Q |
| |
|
| |||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13204078 |
tgacacatat-agttatattaaattatgtaattttctcaaattatcggtgtcagtgtgttagcgtgt |
13204013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University