View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9473_high_5 (Length: 281)
Name: NF9473_high_5
Description: NF9473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9473_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 37 - 269
Target Start/End: Original strand, 43307730 - 43307960
Alignment:
| Q |
37 |
acttgaagccaacaatggaaatgcaatcaacgaaacacttatcttagtttgatatggatcgatccctacatgactggaaaaagttctatttccagccagn |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307730 |
acttgaagccaacaatggaaatgcaatcaacgaaacacttatcttagtttgatatg----gatccctacatgactggaaaaagttctatttccagccaga |
43307825 |
T |
 |
| Q |
137 |
nnnnnncaatgaagatatcaaagtagcgtctttcataca------atacaatgtcgaacttatttgagagtgtcttataaaatcatgcaaaacacatatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43307826 |
aaaaaacaatgaagatatcaaagtagcgtctttcatacaatacatatacaatgtcgaacttatttgagagtgtcttataaaatcatgcaaaacacatatt |
43307925 |
T |
 |
| Q |
231 |
tgaatgaaatatatatacggacctgatagttataggtga |
269 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43307926 |
tgaatgaa----atatacggacctgatagttataggtga |
43307960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 27 - 56
Target Start/End: Complemental strand, 1792427 - 1792398
Alignment:
| Q |
27 |
caagcatcaaacttgaagccaacaatggaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1792427 |
caagcatcaaacttgaagccaacaatggaa |
1792398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University