View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9475_high_1 (Length: 428)
Name: NF9475_high_1
Description: NF9475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9475_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 8e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 42236092 - 42235954
Alignment:
| Q |
1 |
tgcggtggtgaagctgtggataagtggtagattgtgttggtcggttaggattgatggatgtggtaatggggtggtggaagtcgaaggatcagacattgtt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42236092 |
tgcggtggtgatgctgtggataagtggtagattgtgttggtcggttaggattgatggatgtggtaatggggtggtggaagtggaaggatcagacattgtt |
42235993 |
T |
 |
| Q |
101 |
tagatttggcatgagatttggtgagtgaattaatgaatt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235992 |
tagatttggcatgagatttggtgagtgaattaatgaatt |
42235954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 253 - 399
Target Start/End: Complemental strand, 42235854 - 42235696
Alignment:
| Q |
253 |
gaagtgaaaagggagagtgagtgagatttgttttgttttgaggaatggaaattggaatggagtggtactgtggtagtaaatttgt------------tgt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42235854 |
gaagtgaaaagggagagtgagtgagatttgttttgttttgaggaatggaaattggaatggagtggtactgtggtagtaaatttgttgtgttgtggcttgt |
42235755 |
T |
 |
| Q |
341 |
gagagtggaaattgaagaatgagttttcttttttcttctatggtaaaaagtagtagtag |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235754 |
gagagtggaaattgaagaatgagttttcttttttcttctatggtaaaaagtagtagtag |
42235696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University