View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9475_low_10 (Length: 249)
Name: NF9475_low_10
Description: NF9475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9475_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 7 - 249
Target Start/End: Original strand, 17106336 - 17106579
Alignment:
| Q |
7 |
ttcgtgttcttaagttcttcgtctgtgcttgaggtacttctactacttcgaatttcacaatcttttattcaaaaatcgttgtattgatcattacattcct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17106336 |
ttcgtgttcttaagttcttcgtctgtgcttcaggtacttctactactttgaaattcacaatcttttattcaaaaaacgttgtattgatcattacattcct |
17106435 |
T |
 |
| Q |
107 |
tgtgggcttcgtttgctcaaatttcactagagttcctaagccgaatttctaggataatctttgtgctttgttcacttgattttatgaatttgatgctatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106436 |
tgtgggcttcgtttgctcaaatttcactagagttccaaagccgaatttctaggataatctatgtgctttgttcacttgattttatgaatttgatgctatt |
17106535 |
T |
 |
| Q |
207 |
gtagatggatg-nnnnnnnnaacaactattgtagatggatgtgc |
249 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17106536 |
gtagatggatgtttttttttaacaactattgtagatggatgtgc |
17106579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University