View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9476_low_7 (Length: 251)
Name: NF9476_low_7
Description: NF9476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9476_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 51474174 - 51473973
Alignment:
| Q |
1 |
acgctagagagatggcacgagacaataaagaaggagaggttccagatccagggaagg---ggatgcgagtgggagtttatggagaaagagaaggaacacc |
97 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||||| ||||||||||||||||||| | |
|
|
| T |
51474174 |
acgctggagagatggcacgagacaataaagaaggagaggatctagatccagggaaggaggggatgtgagtgggagtttctggagaaagagaaggaacatc |
51474075 |
T |
|
| Q |
98 |
gatggatttggaataatggaaggttggaggtttgagaaaaaaggagtaagaatccaaagaggaataggggtttttgtgtgagaaaaatggtttgaggaag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51474074 |
gatggatttggaataatggaaggttggaggtttgagaaaaaaggagtaagaatccaaagaggaatatgggtttttgtgtgagaaaaatggtttgaggaag |
51473975 |
T |
|
| Q |
198 |
ag |
199 |
Q |
| |
|
|| |
|
|
| T |
51473974 |
ag |
51473973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University