View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9476_low_8 (Length: 247)

Name: NF9476_low_8
Description: NF9476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9476_low_8
NF9476_low_8
[»] chr2 (1 HSPs)
chr2 (19-156)||(38883324-38883461)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 19 - 156
Target Start/End: Original strand, 38883324 - 38883461
Alignment:
19 ttggtgttctgcaacagcattatgtcctttgtggcaacatcatcagtttgcacactctccatccccctaaaggttttcagttggaaatctatgctagcat 118  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
38883324 ttggtgttctgcaacagcattacgtcctttgtggcaacatcatcagtttgcatactctccatccccctaaaggttttcagttggaaatctatgctagcat 38883423  T
119 tgtggtcattgtctttctacctgttaagttgcttcttg 156  Q
    ||||||||||||||||||||||||||||||||||||||    
38883424 tgtggtcattgtctttctacctgttaagttgcttcttg 38883461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University