View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9477_high_12 (Length: 241)
Name: NF9477_high_12
Description: NF9477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9477_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 46354725 - 46354559
Alignment:
| Q |
18 |
atagctaagtattactattaacattcacaaatcatcactatgattgcaatgatttggtggcacgaactcgcacatatatgtttcaatgacatggatttat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
46354725 |
atagctaagtattactattaacattcacaaatcatcactatgattgcaatgatttggtggcacgaactcgcacatatatgtttcaatgatatgggtttat |
46354626 |
T |
 |
| Q |
118 |
tcccaacatcaactaagcgctgtaccttttattttgttatttgcttaaatttttaacagtaaaataa |
184 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354625 |
tcccaacatcaacaaagcgttgtaccttttattttgttatttgcttaaatttttaacagtaaaataa |
46354559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 203 - 241
Target Start/End: Complemental strand, 46354539 - 46354501
Alignment:
| Q |
203 |
cacatggtttaaactcgggaccatgcaaccactaccaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46354539 |
cacatggtttaaactcgggaccatgcaaccactaccaac |
46354501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University