View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9477_high_14 (Length: 232)
Name: NF9477_high_14
Description: NF9477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9477_high_14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 38096500 - 38096731
Alignment:
| Q |
1 |
aaagcagcaggaagggaggctgagcaatgtggggaccacaagcaaaagaagggagagtgttgatgaagagaaagtgtattctggtgatgaagatatatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096500 |
aaagcagcaggaagggaggctgagcaatgtggggacaacaagcaagagaagggagagtgttgatgaagagaaagtgtattctggtgatgaagatatatgt |
38096599 |
T |
 |
| Q |
101 |
gtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagcaaaccgggttgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096600 |
gtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagcaaaccgggttgctt |
38096699 |
T |
 |
| Q |
201 |
ttcaagctgaacctgtgctcaagaaatctaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38096700 |
ttcaagctgaacctgtgctcaagaaatctaat |
38096731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University