View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9477_low_31 (Length: 241)
Name: NF9477_low_31
Description: NF9477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9477_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 42837347 - 42837121
Alignment:
| Q |
1 |
aaacagaaaaaacccaaatataaattgcatttacacaaaccccaattcaatgaattgattcacacaaacccttctcaacaacacaagaagccaacgacat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||| |||| |
|
|
| T |
42837347 |
aaacagaaaaaacccaaaaataaattgcatttacacaaaccccaattcaatgaattgattcacacaaacccttctcaacaactcaggaaaccaacaacat |
42837248 |
T |
|
| Q |
101 |
attgatatttttt--agatctgaattctttgcagctacatattgatcttaaaaacaagacctcgctttatcttctttctcctccatggcaaatagcaaga |
198 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42837247 |
attgattttttttttagatctgaattctttgcagctacatattgatcttaaaaccaagacctcgctttatcttctttctcctccatggcaaatagcaaga |
42837148 |
T |
|
| Q |
199 |
actggaatcaccaaaaattgtaatcag |
225 |
Q |
| |
|
| |||||||||||||||||| |||||| |
|
|
| T |
42837147 |
aatggaatcaccaaaaattgcaatcag |
42837121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 183 - 225
Target Start/End: Original strand, 3137632 - 3137674
Alignment:
| Q |
183 |
atggcaaatagcaagaactggaatcaccaaaaattgtaatcag |
225 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
3137632 |
atggcaaatagcaagaattggaatcaccaaaaattgcaatcag |
3137674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University