View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9480_high_9 (Length: 226)
Name: NF9480_high_9
Description: NF9480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9480_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 209
Target Start/End: Original strand, 20067499 - 20067699
Alignment:
| Q |
9 |
agcagagaaagtaccaaaatcaaaatacagaaagggattatggtcacctgaagaagataacaagcttagtaattatataatgaagcatggtcatagctgc |
108 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20067499 |
agcagaaaaagtacaaaaatcaaaatacagaaagggattatggtcacctgaagaagataacaagcttagtaattatataatgaagcatggtcatagctgc |
20067598 |
T |
 |
| Q |
109 |
tggagctctgtccccattaaagcaggtgagtttcnnnnnnnnnnnncttaaatttataactccttatcaattatatttgtagcatgttcctcatatcttc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20067599 |
tggagctctgtccccattaaagcaggtgcgtttctttttattttttcttaaatttataactccttatcaattatatttgtagcatgttcctcatatcttc |
20067698 |
T |
 |
| Q |
209 |
a |
209 |
Q |
| |
|
| |
|
|
| T |
20067699 |
a |
20067699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 135
Target Start/End: Complemental strand, 45606319 - 45606230
Alignment:
| Q |
46 |
ttatggtcacctgaagaagataacaagcttagtaattatataatgaagcatggtcatagctgctggagctctgtccccattaaagcaggt |
135 |
Q |
| |
|
||||||||||||||||||||| |||| || || || || || | || ||||||||| | ||||||||||||||||| ||||| |||||| |
|
|
| T |
45606319 |
ttatggtcacctgaagaagatcacaaactcagaaactacattcttaaacatggtcatggttgctggagctctgtccctattaaggcaggt |
45606230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University