View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9480_low_10 (Length: 305)
Name: NF9480_low_10
Description: NF9480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9480_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 192 - 296
Target Start/End: Original strand, 54150361 - 54150465
Alignment:
| Q |
192 |
tccatacgattttattatgtatctagatctgtttataagttgagggcagatgtggatgacataaattctgagctactatgtgacaattataagaaggtct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54150361 |
tccatacgattttattatgtatctagatatgtttataagttgagggcagatgtggatgacataaattctgagctactatgtgacaattataagaaggtct |
54150460 |
T |
|
| Q |
292 |
ctgct |
296 |
Q |
| |
|
|||| |
|
|
| T |
54150461 |
ttgct |
54150465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 8 - 115
Target Start/End: Original strand, 54150252 - 54150359
Alignment:
| Q |
8 |
aatgttctttagatcgagattagatacagtcttatattagtgcaaattttgattatttttatgtatcaacagtctggactatttgaactcgattcaatgg |
107 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
54150252 |
aatgttctttagatcgagattagatatagtcttatattagtgcaaattttgattatttttatgtatcaactgtctggactgtttgaactcgattcaatgg |
54150351 |
T |
|
| Q |
108 |
tcaccaat |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
54150352 |
tcaccaat |
54150359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University