View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9480_low_11 (Length: 254)
Name: NF9480_low_11
Description: NF9480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9480_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 7 - 248
Target Start/End: Original strand, 46062168 - 46062409
Alignment:
| Q |
7 |
tcatcgtcgttggcactcacaaactccttcaccaagccatctagagatggtactataccagcctaaaacatgaataattggttcactcagctatcaagat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062168 |
tcatcgtcgttggcactcacaaactccttcaccaagccatctagagatggtactataccagcctaaaacatgaataattggttcactcagctatcaagat |
46062267 |
T |
 |
| Q |
107 |
tcaagtatattattctagtctcttatgatgctaaacatatattttaaactaactttagaagtaagttgaccctgttcatcacggttagtgccacatctcg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062268 |
tcaagtatattattctagtctcttatgatgctaaacatatattttaaactaactttagaagtaagttgaccctgttcatcacggttagtgccacatctcg |
46062367 |
T |
 |
| Q |
207 |
cattaatgaaaaatacaaaatcgtccatatcacgaccaccaa |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46062368 |
cattaatgaaaaatacaaaatcgtccatatcacgaccaccaa |
46062409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University