View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9480_low_22 (Length: 225)
Name: NF9480_low_22
Description: NF9480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9480_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 9 - 210
Target Start/End: Original strand, 30282172 - 30282372
Alignment:
| Q |
9 |
gtttggtgttccatatgtactcttttgggttgatttgttttacacacccctccacttcattctcttaccccaagttttatcaaaatctctatttaccttt |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30282172 |
gtttggttttccatatgtactcttttgggttgatttgttttacacacccc-ccacttcattctcttaccccaggttttatcaaaatctctatttaccttt |
30282270 |
T |
|
| Q |
109 |
gcttattattttatttcttcatatttttactcctcatccacacttgttaaattatttggattgatcactaccgattttcagaacaaaatatatgtatatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30282271 |
gcttattattttatttcttcatatttttactcctcatccacactttttcaattatttggattcatcactaccgattttcagaacaaaatatatgtatatt |
30282370 |
T |
|
| Q |
209 |
tt |
210 |
Q |
| |
|
|| |
|
|
| T |
30282371 |
tt |
30282372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University