View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9481_high_10 (Length: 242)
Name: NF9481_high_10
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9481_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 7260273 - 7260034
Alignment:
| Q |
1 |
tcactggcaccagggtgagtgtgaagtgggataacaccagcaggaccaaggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260273 |
tcactggcaccagggtgagtgtgaagtgggataacaccagcaggaccaaggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgag |
7260174 |
T |
 |
| Q |
101 |
caacaaatgcaggtgtaacggcggcgttgataatgtttgttatgtttccaggtgcaattaagccttcaaatgcaaagtcatctgaggttactgttgaagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7260173 |
caacaaatgcaggtgtaacggcggcgttgataatgtttgttatgtttccaggtgcaattaagccttcaaatgcaaagtcatctgaggttactgttgaagc |
7260074 |
T |
 |
| Q |
201 |
tggcttgcaagggtagcctgaaggagtgtctaagcctttg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7260073 |
tggcttgcaagggtagcctgaaggagtgtctgagcctttg |
7260034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 113
Target Start/End: Complemental strand, 7266052 - 7265988
Alignment:
| Q |
49 |
aggtctaaccttgctgcagagagaccaagaccattaacagctggaaattgagcaacaaatgcagg |
113 |
Q |
| |
|
|||||||| ||||||| || | |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7266052 |
aggtctaattttgctgctgataaaccaagaccattaacagctggaaattgattaacaaatgcagg |
7265988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University