View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9481_high_11 (Length: 241)
Name: NF9481_high_11
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9481_high_11 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 75 - 241
Target Start/End: Complemental strand, 33744878 - 33744712
Alignment:
| Q |
75 |
taatgttgtgatctcaagatttgaaatgggattatgttaaaattatgtaccctaatcaatgtttattggtttatcttcttttgattgtgctcttttttat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33744878 |
taatgttgtgatctcaagatttgaaatgggattatgttaaaattatgtaccctaatcaatgtttattggtttatcttcttttgattgtgctcttttttat |
33744779 |
T |
|
| Q |
175 |
aatgtgtataattggcaggtggatggtaattatggtgagaaacttatggtagttgataaggaagaag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33744778 |
aatgtgtataattggcaggtggatggtaattatggtgagaaagttatggtagttgataaggaagaag |
33744712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University