View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9481_high_15 (Length: 218)
Name: NF9481_high_15
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9481_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 44198921 - 44199110
Alignment:
| Q |
17 |
catcataagctgtaaatttagggaagaaacctacagtcataccattatacagttagaaaatggcaatataaatgaatagaaaacaacagataaaagatca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44198921 |
catcataagctgtaaatttagggaagaaacctacaatcataccattatacagttagaaaatggcaatataaatgaatagaaaacaacagataaaagatca |
44199020 |
T |
 |
| Q |
117 |
ggccagttacaatgacttttccaccattaatgaacgggatacttgtaaaggattgactagagtgatacctgcacatttggatctctggtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44199021 |
ggccagttacaatgacttttccaccattaatgaacgggatacttgtaaaggattgactagagtgatacctgcacatttggatctttggtt |
44199110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University