View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9481_high_7 (Length: 304)
Name: NF9481_high_7
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9481_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 32 - 178
Target Start/End: Complemental strand, 25471054 - 25470909
Alignment:
| Q |
32 |
aggtgattcaagacttaatttccaaaagctgaaatttccaagggggtgtgaataattttcatagagaatgtgatgtattatattatgagtttcaagtcca |
131 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||| |||||||||| | || |
|
|
| T |
25471054 |
aggtgattcacgacttaatttccaaaagctgaaatttccaagggtgtgtgggtaattgtcatagagaatgtgctgtattatattctgagtttcaaat-ca |
25470956 |
T |
 |
| Q |
132 |
atatggtacaattggatcgtcctgctgttgcaactcgttgttgtgca |
178 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25470955 |
atatggcacaattggatcgtcctgctgttgcaactcgttgttgtgca |
25470909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 188 - 297
Target Start/End: Complemental strand, 25453796 - 25453687
Alignment:
| Q |
188 |
cctcaaaagccaagtgatgccttgcactagtgatgaaatcaagttcttgtgattgggaaaatcgaagcatcctaaatacatctcaaggcacttgtttaag |
287 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
25453796 |
cctcaaaatccaagtgatgccttgcactaggcatgaaatcaagttcttgtgattgggaaaatcgaagcatcctaaatgcatctcaaggcacttgtttagg |
25453697 |
T |
 |
| Q |
288 |
gcctttgctt |
297 |
Q |
| |
|
|||| ||||| |
|
|
| T |
25453696 |
gcctatgctt |
25453687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University