View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9481_low_18 (Length: 283)

Name: NF9481_low_18
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9481_low_18
NF9481_low_18
[»] chr6 (2 HSPs)
chr6 (202-278)||(7368628-7368704)
chr6 (19-86)||(7368448-7368515)
[»] chr7 (2 HSPs)
chr7 (202-278)||(45632306-45632382)
chr7 (20-86)||(45632126-45632192)
[»] chr3 (2 HSPs)
chr3 (202-278)||(53159593-53159669)
chr3 (47-86)||(53159778-53159817)
[»] chr2 (2 HSPs)
chr2 (20-86)||(39905597-39905663)
chr2 (210-246)||(39905787-39905823)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 7368628 - 7368704
Alignment:
202 gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgcttct 278  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
7368628 gttctttaataactatagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgtttct 7368704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 7368448 - 7368515
Alignment:
19 atttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca 86  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
7368448 atttgtcactaggacttcattccaattgctacaacgatgcataaccggtaacaattcaatatggtgca 7368515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 45632306 - 45632382
Alignment:
202 gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgcttct 278  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||    
45632306 gttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatgggctttttccctttgtttct 45632382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 45632126 - 45632192
Alignment:
20 tttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca 86  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
45632126 tttgtcactaggacttcattccagttgctacaacgatccataaccggtaacaattcaatatggtgca 45632192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 202 - 278
Target Start/End: Complemental strand, 53159669 - 53159593
Alignment:
202 gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgcttct 278  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||    
53159669 gttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatgggctttttccctttgtttct 53159593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 47 - 86
Target Start/End: Complemental strand, 53159817 - 53159778
Alignment:
47 ctacaacgatccataaccggtaacaattcaatatggtgca 86  Q
    ||||||||||||||||||||||||||||||||||||||||    
53159817 ctacaacgatccataaccggtaacaattcaatatggtgca 53159778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 39905597 - 39905663
Alignment:
20 tttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca 86  Q
    ||||||||||||||||||| ||| |||||| || ||||||||||||||||||||| |||||||||||    
39905597 tttgtcactaggacttcataccagttgctaaaaagatccataaccggtaacaattaaatatggtgca 39905663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 246
Target Start/End: Original strand, 39905787 - 39905823
Alignment:
210 ataactagagtgaccgtggcagttaaggtgtcgccgg 246  Q
    |||||| ||||||||||| ||||||||||||||||||    
39905787 ataactggagtgaccgtgacagttaaggtgtcgccgg 39905823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University