View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9481_low_18 (Length: 283)
Name: NF9481_low_18
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9481_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 7368628 - 7368704
Alignment:
| Q |
202 |
gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgcttct |
278 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7368628 |
gttctttaataactatagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgtttct |
7368704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 7368448 - 7368515
Alignment:
| Q |
19 |
atttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7368448 |
atttgtcactaggacttcattccaattgctacaacgatgcataaccggtaacaattcaatatggtgca |
7368515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 45632306 - 45632382
Alignment:
| Q |
202 |
gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgcttct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45632306 |
gttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatgggctttttccctttgtttct |
45632382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 45632126 - 45632192
Alignment:
| Q |
20 |
tttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca |
86 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45632126 |
tttgtcactaggacttcattccagttgctacaacgatccataaccggtaacaattcaatatggtgca |
45632192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 202 - 278
Target Start/End: Complemental strand, 53159669 - 53159593
Alignment:
| Q |
202 |
gttctttaataactagagtgaccgtggcagttaaggtgtcgccggtttgacattatgggcttcttccctttgcttct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
53159669 |
gttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatgggctttttccctttgtttct |
53159593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 47 - 86
Target Start/End: Complemental strand, 53159817 - 53159778
Alignment:
| Q |
47 |
ctacaacgatccataaccggtaacaattcaatatggtgca |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53159817 |
ctacaacgatccataaccggtaacaattcaatatggtgca |
53159778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 20 - 86
Target Start/End: Original strand, 39905597 - 39905663
Alignment:
| Q |
20 |
tttgtcactaggacttcattccaattgctacaacgatccataaccggtaacaattcaatatggtgca |
86 |
Q |
| |
|
||||||||||||||||||| ||| |||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
39905597 |
tttgtcactaggacttcataccagttgctaaaaagatccataaccggtaacaattaaatatggtgca |
39905663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 210 - 246
Target Start/End: Original strand, 39905787 - 39905823
Alignment:
| Q |
210 |
ataactagagtgaccgtggcagttaaggtgtcgccgg |
246 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
39905787 |
ataactggagtgaccgtgacagttaaggtgtcgccgg |
39905823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University