View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9481_low_38 (Length: 218)

Name: NF9481_low_38
Description: NF9481
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9481_low_38
NF9481_low_38
[»] chr7 (1 HSPs)
chr7 (17-206)||(44198921-44199110)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 17 - 206
Target Start/End: Original strand, 44198921 - 44199110
Alignment:
17 catcataagctgtaaatttagggaagaaacctacagtcataccattatacagttagaaaatggcaatataaatgaatagaaaacaacagataaaagatca 116  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44198921 catcataagctgtaaatttagggaagaaacctacaatcataccattatacagttagaaaatggcaatataaatgaatagaaaacaacagataaaagatca 44199020  T
117 ggccagttacaatgacttttccaccattaatgaacgggatacttgtaaaggattgactagagtgatacctgcacatttggatctctggtt 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
44199021 ggccagttacaatgacttttccaccattaatgaacgggatacttgtaaaggattgactagagtgatacctgcacatttggatctttggtt 44199110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University