View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9483_high_9 (Length: 336)
Name: NF9483_high_9
Description: NF9483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9483_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 318
Target Start/End: Original strand, 8756248 - 8756565
Alignment:
| Q |
1 |
ctcgacaaagcactttcattagtcctaaaatgtcgtgctaatggtctcatgaaacgtgtcttcaccatcatacaagctgcagccttccgtaaaacatcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8756248 |
ctcgacaaagcactttcattagtcctaaaatgtcgtgctaatggtctcatgaaacgtgtcttcaccatcataccagctgcagccttccgtaaaacatcct |
8756347 |
T |
 |
| Q |
101 |
cccatctagaaaactctattggtgatgtttcatggcttcttcgagtatctgcccccgctgatgatcgcggtggcgagtatcttggacttccaccaatagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756348 |
cccatctagaaaactctattggtgatgtttcatggcttcttcgagtatctgcccccgctgatgatcgcggtggcgagtatcttggacttccaccaatagc |
8756447 |
T |
 |
| Q |
201 |
agccaatgaacctatattatgttttatatgggagcagatcgctatgttattcaccggttcacaagaagttcgttctgatgcagctgcttcgcttgtgtca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8756448 |
agccaatgaacctatattatgttttatatgggagcagatcgctatgttattcaccggttcacaagaagttcgttctgatgcagctgcttcgcttgtgtca |
8756547 |
T |
 |
| Q |
301 |
ttggcacgaggcagtgac |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8756548 |
ttggcacgaggcagtgac |
8756565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University