View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9483_low_20 (Length: 374)
Name: NF9483_low_20
Description: NF9483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9483_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 95 - 364
Target Start/End: Original strand, 4600758 - 4601041
Alignment:
| Q |
95 |
attttaagttgtattgtgaattagatatcagaataaaaatacaaactgtccaatctctatctaacaaccgacatttaccggctgtagtgactgcaacgtt |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4600758 |
attttaagttgtattgtgaatcagatatcagaataaaaatacaaactgtccgatctctatctaacaaccgacatttaccggctgtagtgactgcaacgtt |
4600857 |
T |
 |
| Q |
195 |
gaagttgtagtcgatctggattggtaagagagtataccaaactgtacaaatgtatcaagccaagttgatgcaatttcatataaaatcagtctctaagaaa |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4600858 |
gaagttgtagtcaatctggattggtaagagagtataccaaactgtacaaatgtatcaagccaagttgatgcaatttcatataaaatcagtctctaagaaa |
4600957 |
T |
 |
| Q |
295 |
cgtagctatattacgacttatgg--------------ccgcaaccgcaattgtggccataatgtaaaacactttgaggtctctg |
364 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
4600958 |
agtagctatattacgactcatggttttaaattgaagtccgcaactgcagttgtggccgtaatgtaaaacactttgaggtctctg |
4601041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University