View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9483_low_25 (Length: 285)
Name: NF9483_low_25
Description: NF9483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9483_low_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 13 - 285
Target Start/End: Complemental strand, 4601290 - 4601018
Alignment:
| Q |
13 |
gaagcataggctgattttctgttgggtaagaatctgttttggtagatttcacataaatcctatattacatgttgaactaaagtttgtgagattttgaaca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4601290 |
gaagcataggctgattttctgttgggtaagaatctgttttggtagatttcacctaaatcctatattacatgttgaactgaagtttgtgagattttgaaca |
4601191 |
T |
 |
| Q |
113 |
gccgcgttgagttttgtccgacttaattttaatcgagttattttagtcagtgtaatctttacatgctatgaaccattatattacggaaaaatgtgggaaa |
212 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4601190 |
gccgcgttgagttatgtccgacttaattttaatcgagttattttagttagtgtaatctttacatgctatgaaccattatattacggaaaaatgtgggaaa |
4601091 |
T |
 |
| Q |
213 |
atgcggccgatgcaattgaaattttggttgcgaacttgcaatgcagactcagagacctcaaagtgttttacat |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4601090 |
atgcggccgatgcaattgaaattttggttgcgaacttgcaatgcagactcagagacctcaaagtgttttacat |
4601018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University