View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9483_low_30 (Length: 267)
Name: NF9483_low_30
Description: NF9483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9483_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 3402412 - 3402179
Alignment:
| Q |
1 |
catatgaattgtctaacatgtaataataaatttagtcatgcacgtactttaaattgtgaagattccaagttgcttgtactttatttttgt----tatgta |
96 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
3402412 |
catatgaattgtctcacatgtaataa---atttagtcatgcacgtactttaaattgtgaagattccaagttgcttgtactttatttttttgttatatgta |
3402316 |
T |
 |
| Q |
97 |
ccaagaccataagtgaatgtccata----agctattgggttatttggttatactattagctcatatcatatcattggatttcttttataaataaagttca |
192 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3402315 |
ccaagaccataagtgaatgtccatatataagctattgggttatttggttatactattagctcatatcatatcattggatttcttttataaatagagttca |
3402216 |
T |
 |
| Q |
193 |
catgtaatataaatgtccactaaagagaataatataa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3402215 |
catgtaatataaatgtccactaaagagaataatataa |
3402179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 221 - 254
Target Start/End: Complemental strand, 3401800 - 3401767
Alignment:
| Q |
221 |
ataatataattgtctttctccgctctctacctct |
254 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
3401800 |
ataatataattgtctttctcctctctctacctct |
3401767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University