View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9483_low_35 (Length: 261)
Name: NF9483_low_35
Description: NF9483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9483_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 42 - 160
Target Start/End: Complemental strand, 7314231 - 7314113
Alignment:
| Q |
42 |
aatgaatgcttaaaatgtgaatgaaactattacttttctatatcaaatgaactatataagtttagctcagattaaaaatattttaggctgaaacaaaggt |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| | |||||||||||||||| ||||||||| |
|
|
| T |
7314231 |
aatgaatgcttaaaatgtgaatgaaactattacttttctatatcaaatgaacaatataaatttagctcagaatgaaaatattttaggctgcaacaaaggt |
7314132 |
T |
|
| Q |
142 |
ttcaacaaaatatgctata |
160 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7314131 |
ttcaacaaaatatgctata |
7314113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University