View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9484_high_12 (Length: 374)
Name: NF9484_high_12
Description: NF9484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9484_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 105 - 325
Target Start/End: Original strand, 16358318 - 16358540
Alignment:
| Q |
105 |
ttaagggaatataaaacatgggctccagaaggtaacaattcagctactttgtttcccatgttgaaattgaggagcattgcctttagatttagatgtacta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16358318 |
ttaagggaatataaaacatgggctccagaaggtaacaattcagctactttgtttcccatgttgaaattgaggagcattgcctttagatttagatgtacta |
16358417 |
T |
 |
| Q |
205 |
tat--aaaagataaatggatgctaatgcnnnnnnnnnnnngaggtctcttgtcaatatacgtattccctatgtttcacatgttggtcctactttttaggg |
302 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16358418 |
tataaaaaagataaatggatgctaatgctttttattttttgaggtctcttatcaatatacgtattccctatgtttcacatgttggtcctactttttaggg |
16358517 |
T |
 |
| Q |
303 |
actaaattcttttacacacatta |
325 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
16358518 |
actaaattcttttacacacatta |
16358540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University