View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9484_high_22 (Length: 296)
Name: NF9484_high_22
Description: NF9484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9484_high_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 3 - 85
Target Start/End: Complemental strand, 7107922 - 7107840
Alignment:
| Q |
3 |
catagacaggtggaacagctgcttaggcttaaccagtaacatgaacttcatagtttctcatatctgtagggaatgaaattgtt |
85 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7107922 |
cataaacaggtggaacaactgcttaggcttaaccagtaacatgaacttcatagtttctcatatctgtagggaatgaaattgtt |
7107840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 110 - 280
Target Start/End: Complemental strand, 7107630 - 7107443
Alignment:
| Q |
110 |
tattaatttatacattaactcttttgtttgaatgcattacatattcctcctcagactagtgcagatttctttaataagaggct----------------- |
192 |
Q |
| |
|
||||||||||| ||||||||||||| | ||||||||| |||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7107630 |
tattaatttatccattaactcttttatctgaatgcatgacat--tcctcctcagactagtgcaaatttctttaataagaggcttgatttaccatgtttta |
7107533 |
T |
|
| Q |
193 |
--tttgtaaatggttcaaacgttttggcttactccccctttccnnnnnnnatatctatttttggtttacatgtctgatgctctttgcatc |
280 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||| || ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7107532 |
gatttgtaaatggttgaaaggttttggcttagtcccccttccctttttgtatacctatttttggtttacatgtctgatgctctttgcatc |
7107443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University