View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9484_low_57 (Length: 251)
Name: NF9484_low_57
Description: NF9484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9484_low_57 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 23 - 251
Target Start/End: Original strand, 33585457 - 33585685
Alignment:
| Q |
23 |
gctgatcctagtagttggttcttcactgtcctatcatacaaatgaaactctaagtagtttttcttgaaattttcgcggnnnnnnnctttcttagatgctt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33585457 |
gctgatcctagtagttggttcttcactgtcctatcatacaaatgaaactctaagtagtttttcttgaaattttcgcggtttttttctttcttagatgctt |
33585556 |
T |
 |
| Q |
123 |
ctcttaacataaacactgaaagcttgaaaggctcattaaactcgattttcccgttaccgacgttggatgctagagagccggaatttttgtctccattttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33585557 |
ctcttaacataaacactgaaagcttgaaaggctcattaaactcgattttcccgttaccgacgttggatgctaaagagccggaatttttgtctccattttc |
33585656 |
T |
 |
| Q |
223 |
ccattgcaggagcacagattgaacagacc |
251 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33585657 |
ccattgcaggagcacagattgaacagacc |
33585685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University