View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9484_low_66 (Length: 237)
Name: NF9484_low_66
Description: NF9484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9484_low_66 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 11131861 - 11131749
Alignment:
| Q |
1 |
caatttttgaagttttgtcaaatatgtaaaactccttgcaaattgtactagaaagtttatgtttaagtcaacaatataaatttttagatacattgttgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11131861 |
caatttttgaagttttgtcaaatatgtaaaactccttgcaaattgtactagaaaatttatgtttaagtcaacaatataaattcttagatacattgttgga |
11131762 |
T |
|
| Q |
101 |
ctttcttaaagat |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
11131761 |
ctttcttaaagat |
11131749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 180 - 223
Target Start/End: Complemental strand, 11131715 - 11131672
Alignment:
| Q |
180 |
ttcatcactgcatcacttcaggaattacctcatcactcagtaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11131715 |
ttcatcactgcatcacttcaggaattacctcatcactcagtaat |
11131672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University