View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9484_low_67 (Length: 231)
Name: NF9484_low_67
Description: NF9484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9484_low_67 |
 |  |
|
| [»] scaffold0036 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 138 - 208
Target Start/End: Original strand, 9092923 - 9092993
Alignment:
| Q |
138 |
agtgtgcggttttagtttatttactgcttatagcctataatcacttatgtattatctatttctatagcagc |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9092923 |
agtgtgtggttttagtttatttactgcttatagcctataatcacttatgtattatctatttctatagcagc |
9092993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 9092786 - 9092823
Alignment:
| Q |
1 |
ggtggtgccagcgagcgattataccagaaaattggttc |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9092786 |
ggtggtgccagcgagcgattataccagaaaattggttc |
9092823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 9094825 - 9094879
Alignment:
| Q |
154 |
ttatttactgcttatagcctataatcacttatgtattatctatttctatagcagc |
208 |
Q |
| |
|
|||||| ||||||||| | |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
9094825 |
ttatttgctgcttataccatataatcagttatgtataatctatttctatagcagc |
9094879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 97646 - 97700
Alignment:
| Q |
154 |
ttatttactgcttatagcctataatcacttatgtattatctatttctatagcagc |
208 |
Q |
| |
|
|||||| ||||||||| | |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
97646 |
ttatttgctgcttataccatataatcaattatgtataatctatttctatagcagc |
97700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 180 - 208
Target Start/End: Original strand, 95935 - 95963
Alignment:
| Q |
180 |
acttatgtattatctatttctatagcagc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
95935 |
acttatgtattatctatttctatagcagc |
95963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University