View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9484_low_8 (Length: 468)
Name: NF9484_low_8
Description: NF9484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9484_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-168; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 150 - 457
Target Start/End: Complemental strand, 42689131 - 42688824
Alignment:
| Q |
150 |
tcacaatcacataggaccgtttctactctaccatcatatatcagagttaattcctcttttcattatatgagaattgcaagatgtctatagttttgtcttg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42689131 |
tcacaatcacataggaccgtttctactctaccatcatatatcagagtaaattcctcttttcattatatgagaattgcaagatgtctatagttttgtcttg |
42689032 |
T |
|
| Q |
250 |
aatatgaatcctagaaaaattagatattacaaactcctaataccatacttgcagagatccaatgcggagaccttagatgggggtttaatttaggtttatg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42689031 |
aatatgaatcctagaaaaattagatattacaaactcctaataccatacttgcagagatccaatgcggagaccttagatgggggtttaatttaggtttatg |
42688932 |
T |
|
| Q |
350 |
gtatgattgcacacaacataatgaagggccaaaatgtgtcatgacttttatctttgttgctagttttgtttgaggagaaaattaaatatatttcaagtat |
449 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42688931 |
gtatgattgcacacaacataatgaagggccaaaatgtgtcatgactcttatctttgttgctagttttgtttgaggagaaaattaaatatatttcaagtat |
42688832 |
T |
|
| Q |
450 |
tcagaatt |
457 |
Q |
| |
|
|||||||| |
|
|
| T |
42688831 |
tcagaatt |
42688824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 121 - 165
Target Start/End: Complemental strand, 42689191 - 42689147
Alignment:
| Q |
121 |
acagcctatttgggcggccatagggaaaatcacaatcacatagga |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42689191 |
acagcctatttgggcggccatagggaaaatcacaatcacatagga |
42689147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 47
Target Start/End: Complemental strand, 42689237 - 42689208
Alignment:
| Q |
18 |
agtatgctttgaaatggatggcaaacgaga |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42689237 |
agtatgctttgaaatggatggcaaacgaga |
42689208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University