View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9485_high_1 (Length: 271)
Name: NF9485_high_1
Description: NF9485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9485_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 23 - 258
Target Start/End: Complemental strand, 40063636 - 40063401
Alignment:
| Q |
23 |
aaactgtcccactcccttcacatgtccttcactctctaccatcctttcatcccatacttttctcggttcaccccctcactccactattgcaaataaatca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| || |
|
|
| T |
40063636 |
aaactgtcccactcccttcacatgtccttcactctctaccatcctttcatcccatacttttctctgttcacccc-tcactccactattgcaaataaacca |
40063538 |
T |
 |
| Q |
123 |
tcttaatacccacataacaattcatatcatccttcaccattctcattaatagt-aatagtatttctcatttacgcttcaatagtgttggtcacatccatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40063537 |
tcttaatacccacataacaattcatatcatccttcaccattctcattaatagttaatagtatttctcatttacgcttcagtagtgttggtcacatccatt |
40063438 |
T |
 |
| Q |
222 |
gattcattgcgtgcgtcagtgtatatatatgtaagta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40063437 |
gattcattgcgtgcgtcagtgtatatatatgtaagta |
40063401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University