View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9485_high_2 (Length: 225)
Name: NF9485_high_2
Description: NF9485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9485_high_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 17 - 141
Target Start/End: Original strand, 41825480 - 41825604
Alignment:
| Q |
17 |
attctgtgcaaagaaattaattcagggggttcatagctaaaattttatgagaaggtaggtgcaaattttttgatgtcagggtatgcaagtgcatcccctc |
116 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41825480 |
attcggtgcaaagaaattaattcagagggttcatagctaaaattttatgagaaggtaggtgcaaattttttgatgtcagggtatgcaagtgcatcccctc |
41825579 |
T |
 |
| Q |
117 |
aattcaacgtggctccgccactgca |
141 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
41825580 |
aattcaatgtggctccgccactgca |
41825604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 29611597 - 29611525
Alignment:
| Q |
17 |
attctgtgcaaagaaattaattcagggggttcatagctaaaattttatgagaaggtaggtgcaaattttttgat |
90 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29611597 |
attcggtgcaaagaaattaattcagggg-ttcatagctaaaattttatgagaaggtaggtgcaaattttttgat |
29611525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 17711976 - 17711928
Alignment:
| Q |
91 |
gtcagggtatgcaagtgcatcccctcaattcaacgtggctccgccactg |
139 |
Q |
| |
|
||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
17711976 |
gtcaggggatgcaagtgcatcctctcaatggtacgtggctccgccactg |
17711928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 19013233 - 19013185
Alignment:
| Q |
91 |
gtcagggtatgcaagtgcatcccctcaattcaacgtggctccgccactg |
139 |
Q |
| |
|
||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
19013233 |
gtcaggggatgcaagtgcatcctctcaatggtacgtggctccgccactg |
19013185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 17 - 139
Target Start/End: Original strand, 31808311 - 31808433
Alignment:
| Q |
17 |
attctgtgcaaagaaattaattcagggggttcatagctaaaattttatgagaaggtaggtgcaaattttttgatgtcagggtatgcaagtgcatcccctc |
116 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31808311 |
attcggtgcaaagaaattaattcagagggttcatagctaaaattttattagaaggtaggtgcaaattttttgatgtcagggaatgcaagtgcatcccctc |
31808410 |
T |
 |
| Q |
117 |
aattcaacgtggctccgccactg |
139 |
Q |
| |
|
|||| || ||||||||||||||| |
|
|
| T |
31808411 |
aatttaatgtggctccgccactg |
31808433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 17 - 142
Target Start/End: Original strand, 50537280 - 50537405
Alignment:
| Q |
17 |
attctgtgcaaagaaattaattcagggggttcatagctaaaattttatgagaaggtaggtgcaaattttttgatgtcagggtatgcaagtgcatcccctc |
116 |
Q |
| |
|
|||| ||||||| || ||| |||||| ||||||||| | ||||||||||| |||||| |||||| |||| ||||||||||||||||| ||||||||||| |
|
|
| T |
50537280 |
attcggtgcaaacaagttagttcaggaggttcatagtttaaattttatgaaaaggtatgtgcaatattttagatgtcagggtatgcaattgcatcccctc |
50537379 |
T |
 |
| Q |
117 |
aattcaacgtggctccgccactgcat |
142 |
Q |
| |
|
|| |||| |||||||||||||||||| |
|
|
| T |
50537380 |
aagtcaatgtggctccgccactgcat |
50537405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 17 - 139
Target Start/End: Complemental strand, 15827305 - 15827178
Alignment:
| Q |
17 |
attctgtgcaaagaaattaattcagggggttcatagctaaaattttatgagaaggtaggtgcaaattttttgatgtcagggtatgc-----aagtgcatc |
111 |
Q |
| |
|
|||| |||||||||||||| || ||| ||||||||| ||| |||||| |||||||||||| ||| |||||||||| |||||||||| ||||||||| |
|
|
| T |
15827305 |
attcggtgcaaagaaattagttgaggaggttcatagttaagattttacgagaaggtaggtccaatttttttgatgccagggtatgcaagctaagtgcatc |
15827206 |
T |
 |
| Q |
112 |
ccctcaattcaacgtggctccgccactg |
139 |
Q |
| |
|
||||||| |||| ||||||| ||||||| |
|
|
| T |
15827205 |
ccctcaactcaatgtggctctgccactg |
15827178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 14794066 - 14794128
Alignment:
| Q |
147 |
tacttattgtcttaaagttatagatggttatgtt-gtgtcaaaatctcttaagggtttggaat |
208 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14794066 |
tactcattgttttaaagttatagatggttatgtttgtgtcaaaatctcttaagggtttggaat |
14794128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 147 - 208
Target Start/End: Original strand, 15241058 - 15241120
Alignment:
| Q |
147 |
tacttattgtcttaaagttatagatggttatgtt-gtgtcaaaatctcttaagggtttggaat |
208 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15241058 |
tactcattgttttaaagttatagatggttatgtttgtgtcaaaatctcttaagggtttggaat |
15241120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 147 - 204
Target Start/End: Complemental strand, 17538357 - 17538300
Alignment:
| Q |
147 |
tacttattgtcttaaagttatagatggttatgttgtgtcaaaatctcttaagggtttg |
204 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17538357 |
tactcattgccttaaagttatagatggttatgttgtgtctaaatctcttaagggtttg |
17538300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 12181110 - 12181062
Alignment:
| Q |
91 |
gtcagggtatgcaagtgcatcccctcaattcaacgtggctccgccactg |
139 |
Q |
| |
|
||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
12181110 |
gtcaggggatgcaagtgcatcctctcaatggtacgtggctccgccactg |
12181062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 12425538 - 12425490
Alignment:
| Q |
91 |
gtcagggtatgcaagtgcatcccctcaattcaacgtggctccgccactg |
139 |
Q |
| |
|
||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
12425538 |
gtcaggggatgcaagtgcatcctctcaatggtacgtggctccgccactg |
12425490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 139
Target Start/End: Complemental strand, 11273359 - 11273311
Alignment:
| Q |
91 |
gtcagggtatgcaagtgcatcccctcaattcaacgtggctccgccactg |
139 |
Q |
| |
|
||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
11273359 |
gtcaggggatgcaagtgcatcctctcaatggtacgtggctccgccactg |
11273311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University