View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9486_high_18 (Length: 280)
Name: NF9486_high_18
Description: NF9486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9486_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 28205712 - 28205467
Alignment:
| Q |
17 |
agggtcaagaatctagagcttcaaggcatggtatctccctcttcttgttttccatggcatgcttttctttttcttccgtaatgaattttgttacaatgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28205712 |
agggtcaagaatctagagcttcaaggcatggtatctccctcttcttgttttccatggcatgcttttctttttcttccgtaatgaattttgttacaatgta |
28205613 |
T |
 |
| Q |
117 |
taactaagcctttattgagtagggttccaagacaaacctttgtttatttattggattaaagtaatgaannnnnnnnattcattcatgatttacgttttct |
216 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28205612 |
taactaagcctttattgactagggttccaagacaaacctttgtttatttattggattaaagtaatgaa-tttttttattcattcatgatttacgttttct |
28205514 |
T |
 |
| Q |
217 |
atgtttcgtggtttataatgcttttcaagcccaggtcagacaaacct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28205513 |
atgtttcgtggtttataatgcttttcaagcccaggtcagacaaacct |
28205467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University