View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9486_high_24 (Length: 247)
Name: NF9486_high_24
Description: NF9486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9486_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 74 - 235
Target Start/End: Complemental strand, 8773624 - 8773463
Alignment:
| Q |
74 |
gttgggtaaaccgaaagaactttgtgtagtttaagccggtttagttttgtgtcgaactctaaataatatatgatttaatggnnnnnnnngttggtgaaat |
173 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
8773624 |
gttgggtaaaccgaaagtactttgcgtagtttaagccggtttagttttgtgtcgaactctaaataatatacgatttaatgatttttcttgttggtgaaat |
8773525 |
T |
 |
| Q |
174 |
cttgcacaaaataaagattgttaattgctcactttcctctttaccaatcactctctctgctt |
235 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8773524 |
cttgcacaaaatgaagattgttaattgctcattttcctctttaccaatcactctctctgctt |
8773463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 163 - 221
Target Start/End: Complemental strand, 8775880 - 8775822
Alignment:
| Q |
163 |
gttggtgaaatcttgcacaaaataaagattgttaattgctcactttcctctttaccaat |
221 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
8775880 |
gttggtgcaatcttgcccaaaataaagattgttaattgctaacttttctctttaccaat |
8775822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 171 - 221
Target Start/End: Original strand, 8787734 - 8787784
Alignment:
| Q |
171 |
aatcttgcacaaaataaagattgttaattgctcactttcctctttaccaat |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
8787734 |
aatcttgcccaaaataaagattgttaattgctaacttttctctttaccaat |
8787784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University