View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9486_low_24 (Length: 366)
Name: NF9486_low_24
Description: NF9486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9486_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 8 - 360
Target Start/End: Original strand, 44281543 - 44281898
Alignment:
| Q |
8 |
cagcagagaagagactcaatgagcttggttacaagcaagaactaagaagagaaatggtttttgttcttttgccatcttgttcaaaaaattctcaaaaata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44281543 |
cagcagagaagagactcaatgagcttggttacaagcaagaactaagaagagaaatggtttttgttcttttgccatcttgatcaaaaaattctcaaaaata |
44281642 |
T |
|
| Q |
108 |
aagtaacannnnnnnn--ggtactaaatctgttaattttttctatt-attgtgcagactatgttcaaaactcttgcgatagcattttcaacaatgacgct |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44281643 |
aagtaacattttttttttggtactaaatctgttaattttttctatttattgtgcagactatgttcaaaactcttgcgatagcattttcaacaatgacgct |
44281742 |
T |
|
| Q |
205 |
tttcactggaatcacgcctctgtatggttctagccttctgtatgcaggccctgcaagtcttgtttggggatgggttgttgtttgtttcttcacttggttt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44281743 |
tttcactggaatcacgcctctgtatggttctagccttctgtatgcaggccctgcaagtcttgtttggggatgggttgttgtttgtttcttcacttggttt |
44281842 |
T |
|
| Q |
305 |
gttgggattgcaatggcggaaatatgttcatcttttccggtttgtctctgctcctc |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44281843 |
gttgggattgcaatggcggaaatatgttcatcttttccggtttgtctcttctcctc |
44281898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 4e-29; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 9 - 86
Target Start/End: Original strand, 41367723 - 41367800
Alignment:
| Q |
9 |
agcagagaagagactcaatgagcttggttacaagcaagaactaagaagagaaatggtttttgttcttttgccatcttg |
86 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
41367723 |
agcagagaagagaatcaatgagcttggttacaagcaagaactaagaagagaaatggtttttgttctattgccaccttg |
41367800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 159 - 210
Target Start/End: Original strand, 41367877 - 41367928
Alignment:
| Q |
159 |
agactatgttcaaaactcttgcgatagcattttcaacaatgacgcttttcac |
210 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
41367877 |
agactatgttcaaaactctcgcgatagcattttcaacaatgacacttttcac |
41367928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 289 - 321
Target Start/End: Original strand, 41367993 - 41368025
Alignment:
| Q |
289 |
tttcttcacttggtttgttgggattgcaatggc |
321 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
41367993 |
tttcttcacttagtttgttgggattgcaatggc |
41368025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University