View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9486_low_39 (Length: 269)
Name: NF9486_low_39
Description: NF9486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9486_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 5399217 - 5399465
Alignment:
| Q |
1 |
agaatcacttccttatacatgtttcagttttcagacatgtggatggatagaacatagaacatagtagaacacagaactgaaacaagttttgttgttgaac |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399217 |
agaatcacttccttatatatgtttcagttttcagacatgtggatggatagaacatagaacatagtagaacacagaactgaaacaagttttgttgttgaac |
5399316 |
T |
 |
| Q |
101 |
tcaaactcaaactcaaacacagcaatgtcttcaatcacatgcataactcaccaacccatcatttcaaattctaagtctttaatcacttcacaagtttctt |
200 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5399317 |
t------caaactcaaacacaacaatgtcttcaatcacatgcataactcaccaacccattatttcaaattctaagtctttaatcacttcgcaagtttctt |
5399410 |
T |
 |
| Q |
201 |
ccacaaacttgtcttcttctcggtttcttggtattagagttaagagtgttggatg |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5399411 |
ccacaaacttgtcttcttctcggtttcttggtattagagttaagagtgttcgatg |
5399465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University