View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9486_low_55 (Length: 237)
Name: NF9486_low_55
Description: NF9486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9486_low_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 49041527 - 49041750
Alignment:
| Q |
1 |
ctttccctgtctcatcttctttctggtaaacacagttatagttcttgtcatcagctcctttatgggttcgaactgtatgaacaagcttgtatttggaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041527 |
ctttccctgtctcatcttctttctggtaaacacagttatagttcttgtcatcagctcctttatgggttcgaactgtatgaacaagcttgtatttggaacg |
49041626 |
T |
 |
| Q |
101 |
ggttcgatcagaggacttattggaaagaagtatggcggcgccacccattcggaaaatgcaattagaaagaagcattgaacgatcatttccaaagtaccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041627 |
ggttcgatcagaggacttattggaaagaagtatggcggcgccacccattcggaaaatgcaattagaaagaagcattgaacgatcatttccaaagtaccaa |
49041726 |
T |
 |
| Q |
201 |
ttgagggttaaattctctgtgctc |
224 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
49041727 |
ttgagggttaaattctcggtgctc |
49041750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 163
Target Start/End: Complemental strand, 49039901 - 49039743
Alignment:
| Q |
5 |
ccctgtctcatcttctttctggtaaacacagttatagttcttgtcatcagctcctttatgggttcgaactgtatgaacaagcttgtatttggaacgggtt |
104 |
Q |
| |
|
|||||| || || ||||| ||| | ||||| || ||| ||||||||| |||||| ||| |||||||| |||||| | |||||| ||||| |||| |
|
|
| T |
49039901 |
ccctgtttcgtcctctttttggaacacacaattgtagctcttgtcattggctcctgaatgagttcgaacgctatgaagtaacttgtacttggattgggtc |
49039802 |
T |
 |
| Q |
105 |
cgatcagaggacttattggaaagaagtatggcggcgccacccattcggaaaatgcaatt |
163 |
Q |
| |
|
| |||| |||| |||||||| ||||||| ||| || || |||||||||||||| ||||| |
|
|
| T |
49039801 |
ctatcaaaggatttattggagagaagtacggcagctcctcccattcggaaaatacaatt |
49039743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University