View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9486_low_58 (Length: 227)
Name: NF9486_low_58
Description: NF9486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9486_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 32138234 - 32138447
Alignment:
| Q |
1 |
ctccaaaccacattttcattttgcaaaaagagctcaatagtaggcacagctgcacccaatcgtgtcccagtcaaattagtgtaacaaaattcaaaaggcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32138234 |
ctccaaaccacattttcattttgcaaaaagagctcaatagtaggcacagctgcacccaatcgtgtcccagtcaaattagtgtaacaaaattcaaaaggcg |
32138333 |
T |
 |
| Q |
101 |
caaccgaacccaccctctttatgtttcttgcagcagacgctttcacgaaagtgtctgtaactgctttgtaaatagaagcttctaaaaccgtgtaaggatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32138334 |
caaccgaacccaccctctttatgtttcttgcagcagacgctttcacgaaagcgtctgtaactgctttgtaaatagaagcttctaaaaccgtgtaaggatc |
32138433 |
T |
 |
| Q |
201 |
aaccgtactaatct |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32138434 |
aaccgtactaatct |
32138447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 22 - 214
Target Start/End: Original strand, 32147645 - 32147837
Alignment:
| Q |
22 |
tgcaaaaagagctcaatagtaggcacagctgcacccaatcgtgtcccagtcaaattagtgtaacaaaattcaaaaggcgcaaccgaacccaccctcttta |
121 |
Q |
| |
|
|||||| | |||||||||||||| ||| | |||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||| ||||||| |||| |
|
|
| T |
32147645 |
tgcaaataaagctcaatagtaggtacatccgcacccaatcgtgtcccagtcacattagtgtaacaaaactcaaaaggtgcaaccgaatccacccttttta |
32147744 |
T |
 |
| Q |
122 |
tgtttcttgcagcagacgctttcacgaaagtgtctgtaactgctttgtaaatagaagcttctaaaaccgtgtaaggatcaaccgtactaatct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||| |||| |
|
|
| T |
32147745 |
tgtttcttgcagcagacgctttcacgaaagcgtctgtaactgctttgtaaatagaagcttccaaaactgtgtaaggatcaacggtacttatct |
32147837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 119 - 214
Target Start/End: Original strand, 32126551 - 32126646
Alignment:
| Q |
119 |
ttatgtttcttgcagcagacgctttcacgaaagtgtctgtaactgctttgtaaatagaagcttctaaaaccgtgtaaggatcaaccgtactaatct |
214 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32126551 |
ttatgtttcttgcaacagatgctttcacaaaagcgtctgtaactgctttgtaaatagaagcttctagaaccgtgtaaggatcaaccgtactaatct |
32126646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University