View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9487_high_2 (Length: 280)

Name: NF9487_high_2
Description: NF9487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9487_high_2
NF9487_high_2
[»] chr2 (1 HSPs)
chr2 (1-94)||(14789161-14789254)


Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 14789254 - 14789161
Alignment:
1 ccaaaataaaatgtgatagcatgagtgagttgatgaatgaattaagtattggagtaggtcacaagttgaacttatacgtgctgggatcaatcag 94  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14789254 ccaaaataaaatgtgagagcatgagtgagttgatgaatgaattaagtattggagtaggtcacaagttgaacttatacgtgctgggatcaatcag 14789161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University