View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9487_low_4 (Length: 298)
Name: NF9487_low_4
Description: NF9487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9487_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 49338916 - 49338757
Alignment:
| Q |
18 |
catgttatatggttgatgatgtacaaattgaccattggagataaatttcaaaggatgcatactccactcacaaaggagacatgccgacgacttagatcaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49338916 |
catgttatatggttgatgatgtacaaattgaccattggagataaatttcaaaggatgcatactccactcacaaaggagacatgccgacgacttagatcaa |
49338817 |
T |
 |
| Q |
118 |
gtgttaaaactatttccaagtccgaaccttgatttggttaactaccccctcacaatcact |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49338816 |
gtgttaaaactatttccaagtccgaaccttgatttggttaactaccccctcacaatcact |
49338757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 220 - 288
Target Start/End: Complemental strand, 49338748 - 49338680
Alignment:
| Q |
220 |
tgcactaattatttgtatatcaaaaagtcgtccatagaactgaatgctaaactaatgacaaaccctttg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49338748 |
tgcactaattatttgtatatcaaaaagtcgtccatagaactgaatgctaaactaatgacaaaccctttg |
49338680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University