View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9487_low_7 (Length: 251)

Name: NF9487_low_7
Description: NF9487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9487_low_7
NF9487_low_7
[»] chr4 (1 HSPs)
chr4 (15-251)||(6878660-6878896)


Alignment Details
Target: chr4 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 6878660 - 6878896
Alignment:
15 aaggggacggtgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtct 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6878660 aaggggacggtgggcgaaagagggagacgaaggaaatgacgggcactcactggccgaagggtggcgggaggcggtggaggagctaatggaatggctgtct 6878759  T
115 ccggtggcgcatgacacagtccggtggcatggggaaaggcatttggagaagacaagatttgagacaaagcctacggcaatgcttctgcagacattgcatt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
6878760 ccggtggcgcatgacacagtccggtggcatggggaaaggcatttggagaagacaagattcgagacaaagcctacggcaatgcttctgcagacattgcatt 6878859  T
215 actctgatttggagaaggcagagactgccatagtgga 251  Q
    |||||||||||||||||||||||||||||||||||||    
6878860 actctgatttggagaaggcagagactgccatagtgga 6878896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University