View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9488_high_4 (Length: 325)
Name: NF9488_high_4
Description: NF9488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9488_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 17 - 308
Target Start/End: Complemental strand, 34078972 - 34078681
Alignment:
| Q |
17 |
taggtataggaagaagaagattgaggaaatgggagtgacagaagaggaatatttggcgaagcaatttgagattaaggaagatgttccggaggagttggag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078972 |
taggtataggaagaagaagattgaggaaatgggagtgacagaagaggaatatttggcgaagcaatttgagattaaggaagatgttccggaggagttggag |
34078873 |
T |
 |
| Q |
117 |
actaagtgggcaggaccgttggtggtgaagttggtgccgccgagggattggccgccgagagggtgggaggtggatcgtgaagagctcgcgtttattcgtg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078872 |
actaagtgggcaggaccgttggtggtgaagttggtgccgccgagggattggccgccgagagggtgggaggtggatcgtgaagagctcgcgtttattcgtg |
34078773 |
T |
 |
| Q |
217 |
aagcgcataagatggaggcaaagagggtgaggttggaggatattgaaaatggtgttagaactgaaactgatgatgtgtgtttggttaggtat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34078772 |
aagcgcataagatggaggcaaagagggtgaggttggaggatattgaaaatggtgttagaactgaaactgatgatgtgtgtttggataggtat |
34078681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University