View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9488_high_8 (Length: 241)
Name: NF9488_high_8
Description: NF9488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9488_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 53809734 - 53809958
Alignment:
| Q |
1 |
atttagtttcctaacaaaaagctaatgtgaaataaaagaaattataataatatgtaattgtttatttagggtgatagattttgaattatgtgaaactaat |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53809734 |
atttagtttcttaacaaaaagctaatgtgaaataaaagaaattataataatatgtaattgtttatttagg-tgatagattttgaattatgtgaaactaat |
53809832 |
T |
 |
| Q |
101 |
acttaatcaacaaaggtcgggtttgattgatctggtttagagttgattatagagggagaaaaatcaaatcaatgtaa-ttggtttggttggtaataatgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53809833 |
acttaatcaacaaaggtcgggtttgattgatttggtttagagttgattatagagggaaaaaaatcaaatcaatgtaatttggtttggttggtaataatgg |
53809932 |
T |
 |
| Q |
200 |
attgcatgttgtaatagagtagtagt |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
53809933 |
attgcatgttgtaatagagtagtagt |
53809958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University