View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9488_low_37 (Length: 234)
Name: NF9488_low_37
Description: NF9488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9488_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 47581440 - 47581642
Alignment:
| Q |
13 |
attatactgtgtattctttggctacgtgtgtaagttctcgctaactaattgtctttgtaagatttttggttaggtcattgtcagcgtatagaaattaaca |
112 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47581440 |
attatactgtatattctttggctacgtgtgtaagttctcgctaactaattgtctttgtaagatttttggttaggtcactgtcagcgtatagaaattaaca |
47581539 |
T |
|
| Q |
113 |
tttgacaagatttttgtaacttgggatatgtagcttctgcgggtcttggttttctccagttctgtaatctcaatagtttcagaaccaaatttgtgttagg |
212 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47581540 |
tttgacaagatttttgtaacttggaatatgtagcttctgcgggtcttggttttctccagttctgtaatctcaatagtttcagaaccaaatttgtgttagg |
47581639 |
T |
|
| Q |
213 |
ctt |
215 |
Q |
| |
|
||| |
|
|
| T |
47581640 |
ctt |
47581642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 139 - 215
Target Start/End: Original strand, 8685473 - 8685549
Alignment:
| Q |
139 |
tatgtagcttctgcgggtcttggttttctccagttctgtaatctcaatagtttcagaaccaaatttgtgttaggctt |
215 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| ||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
8685473 |
tatgtagcttctgctggtcttggttttatccagttctgtaacctcaacagtttcagaaccaaatttgtgctaggctt |
8685549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University